[lnkForumImage]
TotalShareware - Download Free Software
Confronta i prezzi di migliaia di prodotti.
Asp Forum
 Home | Login | Register | Search 


 

Forums >

comp.lang.python

Re: How to POST call and retrieve result page

Mike Meyer

1/11/2008 4:57:00 PM

On Fri, 11 Jan 2008 14:44:19 +0530 "suyash jape" <suyashjape@gmail.com> wrote:

> Hi all
> i want to access a web page through python script, fillup the necessary
> fields,
> and press submit button (which does POST call) and retrieve the result page
> and retrieve some values from it.
>
> Here is the script i have written till now.
>
> >import urllib2
> > # create array of name/value pairs
> > self.params = urllib.urlencode({'seqname': 'BioSequence', 'sequence':
> 'ATACATTATCCAAACATAAAAAGCATGGCTT'})
> >
> > # send http-post
> > request = urllib.urlopen("http://www.hydrazome.metazome.net/search...,
> params)
> >
> > # read back each line of reply
> > line = request.read()
> >print line
>
> This script fills up the correct values in the search.php page.But i am not
> sure if it is doing the POST (submit call).
> Beacause in 'line' varialble, i am getting the search.php page.Not the
> result page which is blast_results.php.
>
> How to retrieve the result page?

Sounds like you're not POSTing to the right page.

The form on .../search.php lets you fill in values, but those values
are not necessarily POSTed to search.php. In particular, the form element
has an action attribute that has a URL to which the values on the page
should be posted. If that points to .../blast_results.php, then that's
the page you need to pass to urlopen with your data.

<mike
--
Mike Meyer <mwm@mired.org> http://www.mired.org/consu...
Independent Network/Unix/Perforce consultant, email for more information.